ChIP Experiment Report
ChIP experiment reports contain detailed information and
formatted data derived from ChIP-ChIP and ChIP-seq experiments.
Reports are accessed by clicking the "View Report" button for the
desired experiment listed on the "Browse by ChIP-chip and ChIP-seq
experiments" link under the transcription
factors search option.
For more information about the ChIP-chip and ChIP-seq
experiments included in TRANSFAC, click here.
Anatomy of a ChIP Experiment Report
The general structure of a ChIP Experiment Report is described
below.
- Access help by clicking the help menu
and clicking the ChIP experiment report help
link.
- Navigate to the desired section of the report by opening the
table of contents
Points of navigation within the report are indicated by the
following visual cues.
- Links to additional reports within the BKL are presented as
regular text links.
- Links to external resources are indicated by a blue bubble,
such as the PubMedID link shown here:
.
- Links to send data to another tool within the BKL are indicated
by a gray bubble, such as the Pathfinder link shown
here:
.
- Links providing an option to download content are indicated by
a green bubble, such as the FASTA link shown
here:
.
|
Author Summary |
Provides a summary of the study from the PubMed article, or
indicates the data comes from the ENCODE project. |
|
|
|
Experimental Details |
Provides a summary of the experimental details of the study. |
|
|
Binding factor |
|
Lists the binding factor studied in the experiment which is
hyperlinked to the relevant Locus Report. |
|
Consensus binding sequence for the factor |
|
TRANSFAC's consensus binding sequence for the factor studied in the
experiment is provided when available (this is the matrix which is
used for Match analysis of the fragments when available). The
Profiles button can be used to save the profile directly for use
with the Match algorithm for prediction of additional transcription
factor binding sites. |
|
Details of the experiment which identified binding by the
factor |
|
Provides additional details regarding the experimental method
employed and the tissue source used in the experiment, when
available. |
|
|
|
Data Prepared for Further Analysis |
Provides prepared data for export, for use by tools within the BKL
or for with 3rd party tools. |
|
|
Sequenced fragments |
|
Complete fragments |
|
Selecting "Complete fragments" followed by clicking the FASTA
button allows the user to export the complete fragment sequences.
Alternatively, clicking the .BED button allows the user to export
the same sequences as genomic coordinates. The reference genomes
supported are hg38, mm10 and rn6. |
Example:
>PR000007623|HIF-1alpha|human, Homo sapiens|MCF-7|
reference(s):
>Mole, D. R. et al.; J Biol Chem; 284, 16767-16775 (2009);
PMID:19386601
>binding fragments:
...
>FR000918145|HSA_Feb2009|20|52687118|52687517|PFDN4|BCAS1
cctgctggctgaatacacagagcagggcaaacacaagcctgggtggagtcctcccttctccccggaccatcctgcagaaa
caggttctcttcctgatgtgGGGCTGCCCTCCCAACTCCAATAAAAACTGAGCACCTGACTCCTCTCGCATTAATGCCTC
CCTGGCACCCCAAGTATTCTACCCAGTGCCCCTCACCTACTGAGGCTGCCGGGTTGACCTGGGGAAGCAGTTTCCTTCCC
CAGTAACCGTAGGTCATGGTCAGAGCAGGGAAAACACGTTCTGTGAGATTTTGTAGTTCTgtctgctgacttcagaacac
cacctccaccaccacctaaccacctaattggaaggaaatagcttctcatccactcaactacccctagtcatgtaaacctt
...
Description:
>FR000918145|HSA_Feb2009|20|52687118|52687517|PFDN4|BCAS1
1. Accession number for the binding fragment (s. ChIP Fragment
Report:
http://devel.incyte.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=ChipReport&chip_acc=FR000918145)
2. Genome build
3. Chromosome number
4. Start position
5. End position
6. Gene symbol(s) of gene(s) located in the vicinity based on a 150
kb window
|
|
Predicted best binding sites within the fragments |
|
Selecting "Predicted best binding sites within the fragments"
followed by clicking the FASTA button allows the user to export the
portion of the fragment sequence that most likely represents the
binding site, as predicted by the Match algorithm (with the
consensus/matrix displayed in the section above), for those
fragments for which the information is available. |
Example:
>PR000007623|HIF-1alpha|human, Homo sapiens|MCF-7|matrix:
V$HIF1_Q3|reference(s):
>Mole, D. R. et al.; J Biol Chem; 284, 16767-16775 (2009);
PMID:19386601
>predicted binding sites in ChIP fragments:
...
>FR000918145|HSA_Feb2009|20|52687388|52687401|1.000|0.885|PFDN4|BCAS1
GAAAACACGTTCTG
...
Description:
>FR000918145|HSA_Feb2009|20|52687388|52687401|1.000|0.885|PFDN4|BCAS1
1. Accession number for the binding fragment (s. ChIP Fragment
Report:
http://devel.incyte.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=ChipReport&chip_acc=FR000918145)
2. Genome build
3. Chromosome number
4. Start position (of the best scoring site, based on the consensus
for the respective factor, within the fragment)
5. End position (of the best scoring site, based on the consensus
for the respective factor, within the fragment)
6. Core similarity score (CSS) for the best scoring site, based on
the consensus for the respective factor, within the fragment
7. Matrix similarity score (MSS) for the best scoring site, based
on the consensus for the respective factor, within the fragment
8. Gene symbol(s) of gene(s) located in the vicinity based on a 150
kb window
|
|
|
Genes located near sequenced fragments |
|
150,000 bp of sequenced fragments |
|
Focuses on genes that fall within 150,000 bp of the sequenced
fragments. Clicking the export button allows the user to export a
tab-delimited list of genes for further analysis or use in 3rd
party tools. |
Example:
>PR000007623|HIF-1alpha|Homo sapiens|| binding fragments
associated Genes:
...
BCAS1
...
PFDN4
...
Description:
BCAS1
Gene symbol(s) of gene(s) located in the vicinity of the binding
fragments based on a 150 kb window
|
|
Please note: |
|
Genes have been associated with the DNA fragments based solely on
their proximity. To provide information about the closely located
genes, we mapped DNA fragments on the genomic sequence and then
looked for annotated transcription start sites (TSS) and exons
within a window of 150 kb on both sides of the fragment. The TSS or
exon closest to each end of the DNA fragment was selected, and the
respective gene was assigned to the fragment as "nearest gene".
This procedure resulted in the association of one, two, or zero
gene(s) with each fragment. |
|
|
|
10,000 bp of sequenced fragments |
|
Focuses on genes that fall within 10,000 bp of the sequenced
fragments. Clicking the export button allows the user to export a
tab-delimited list of genes for further analysis or use in 3rd
party tools. |
|
Please note: |
The 10,000 bp option is only available for experiments using human
genes.
Genes have been associated with the DNA fragments based solely on
their proximity. To provide information about the closely located
genes, we mapped DNA fragments on the genomic sequence and then
looked for annotated transcription start sites (TSS) and exons
within a window of 10,000 bp on both sides of the fragment. The TSS
or exon closest to each end of the DNA fragment was selected, and
the respective gene was assigned to the fragment as "nearest gene".
This procedure resulted in the association of one, two, or zero
gene(s) with each fragment. |
|
|
|
Specified bp of sequenced fragments |
|
Focuses on genes that fall within the distance of sequenced
fragments specified by the user. Clicking the export button allows
the user to export a tab-delimited list of genes for further
analysis or use in 3rd party tools. |
|
|
|
|
|
